Identification Of Respiratory Viruses Using Real-time PCR

Topics:
Words:
2076
Pages:
5
This essay sample was donated by a student to help the academic community. Papers provided by EduBirdie writers usually outdo students' samples.
Updated:
08.01.2026

Cite this essay cite-image

Viral respiratory infections can cause many different illnesses related to the respiratory tract. These diseases may range from mild infections to more severe ones that can even lead to death. The most common respiratory disease is known as a cold, which is a mild infection that affects the upper respiratory tract and it is harmless in most cases. Common colds can be caused by many different types of viruses, the most frequent ones being rhinoviruses. Viral pneumonia, in the other hand, is an example of a lower respiratory tract infection, mainly caused by influenza viruses, in which the tissues in the lungs get inflamed and fluid enters the air sacs – this leads to shortness of breath, an excruciating pain in the chest, chills, etc. For people that are older than 65 years old, toddlers, smokers or immunocompromised people the risks of pneumonia being a life-threatening disease are very high (Medical Microbiology 1996). According to Public Health England, influenza A and B, respiratory syncytial virus, rhinovirus, parainfluenza and adenovirus are the most common types of respiratory viruses in England and Wales (Public Health England 2018).

Humans are mostly affected by influenza A and B during winter season. In most cases they have to be hospitalized and sometimes it can be fatal. (Stanford Children’s Health n.d.). These viruses are mainly transmitted via aerosols, through a sneeze per example, or by getting in contact with an object or food that had previously been touched by an infected person (Cowling, Fang, Olsen et al. 2014). Human rhinovirus (HRV) is often related to infections in the upper respiratory tract and are often treated with antiviral drugs, but recent tests, such as PCR assays, show HRV to also be the cause to many pulmonary diseases in children, elderly and immunocompromised adults, which is similar to the effects of the influenza viruses (Jacobs, Lamson and Walsh 2013). Respiratory syncytial virus mostly relates to infections in the lower respiratory tract in infants that might later develop bronchiolitis and will need to be hospitalized. In all of these cases, the person might be infected more than once by the same virus. Mutations in these microorganisms cause the antibodies to not recognize them when they enter the body and so, infection will occur again (Meng, Stobart, Hotard, et al. 2014).

Save your time!
We can take care of your essay
  • Proper editing and formatting
  • Free revision, title page, and bibliography
  • Flexible prices and money-back guarantee
Place an order
document

One of the long-term solutions to prevent viruses are vaccines. These are made of the dead microbe and its surface proteins. When inserted into the body, there will be an immune response to this agent, which will cause the immune system to recognize the virus in the future and destroy it. (Ahmed and Orenstein 2017)

There are many different techniques performed for the diagnosis of viral diseases, such as cell culture/viral culture, ELISA, RT-PCR or simply PCR. One of the main advantages of viral cultures, is that they allow the identification of many different viruses at the same time, which can also include viruses that were not expected to be present when the culture was made. On the other hand, not every virus grows in the same environment, so more than one culture must be designed to allow cell growth and it can be time consuming (Storch 2000). The Enzyme-Linked Immunosorbent Assay (ELISA) is a quick test that is either used to detect agents that are strange to the organism – antigen ELISA – or to detect the antibodies released as a response to an infectious agent – antibody ELISA. These will show if the person had previously been in contact with a certain virus or if they are infected at that time (Thermo Fisher Scientific n.d.).

Real-Time PCR was the technique used in this project for the identification of viruses. This method is quick, highly sensitive, and the risks of contamination are low. It uses pairs of primers that hybridize to each strand of the DNA molecule. Taq polymerase then creates a complementary strand for the hybridized primer. The reaction goes through different cycles with different temperatures and many copies from the initial DNA sequence of interest are produced (Mackay, Arden and Nitsche 2002).

The aim of this experiment was to identify what viruses were present in different unknown samples by using BLAST to design primers, PCR to clone the DNA molecules and gel electrophoresis to observe the results.

Methods

To identify what virus was present in each sample, the following steps had to be taken.

Purification of viral RNA

Cells were broken down by centrifugation and RNA was extracted. By using the QIAmp Viral RNA Mini Kit, the viral RNA was purified. This process was carried out according to the protocol in the QIAmp Viral RNA Mini Handbook, in pages 27-30, although 100 μL of the sample was used instead of 140 μL and the concentration of ethanol was 100%. A nanodrop test was made to determine if RNA was present.

Preparation of cDNA

To synthesize the cDNA from the viral RNA that was previously extracted, the guide provided by Tetro cDNA Synthesis Kit Protocol was followed. With this, two samples for each unknown virus were prepared and the enzyme reverse transcriptase was added to one sample of each virus. Therefore, there was one sample with the enzyme and one sample without it for each virus.

These were then incubated for 10 minutes at 250C and for 30 minutes at 450C, to allow the reaction to run. After that, these were incubated at 850C for 5 minutes to stop reaction and the samples were incubated at -200C for long term storage.

Primers

The following forward and reverse primers were designed using BLAST for each virus so it would be possible to produce bands with different sizes:

  • Influenza A forward primer – GAGATGTGCCACAGCACACAAA
  • Influenza A reverse primer – GACCAACACTGATTCAGGACC
  • Influenza B forward primer – CAAGGGAATACAACTTAAAAC
  • Influenza B reverse primer – GCTTCATCTGGGGGCATTTC
  • RSV forward primer – GCGGATTCAATAATGTTATC
  • RSV reverse primer – GGATAAGTGTTTAGTTTATAG
  • Rhinovirus forward primer – CATCCCAGTGTATTTTATGATG
  • Rhinovirus reverse primer – CCTTAATATATGTAACTAGAG

Preparation for PCR

For positive controls, 4 samples were produced, one for each known virus. In these, 0.4 μM of cDNA was added with a total of 3.4 μM of primers and 15 μL of master mix.

A separate sample containing water was used as negative control.

To another Eppendorf tube, 2 μL from the unknown cDNA that was previously prepared was added – 0.4 μM – together with 1μL of each primer – which totals a concentration of 3.4 μM – and 15μL of master mix. This master mix was made by technicians and it contains dNTPs, Taq Polymerase, buffer, primers and water. Thus, there was a total of 4 Eppendorfs with the unknown samples, in which two were treated with RT and two were not.

PCR

PCR was performed using the following cycling conditions: 94°C for 30sec, 30 cycles of 95°C for 30 sec, 50°C for 30sec, 72°C for 60 sec followed by 72°C for 10min, and it was held at 4°C.

Gel electrophoresis

The gel used for the electrophoresis was the 2% agarose gel. After this had set, 50 ml of TBE buffer was poured into the tank. Then, 1 μL of bromophenol blue dye and 5 μL of every sample were added to the wells and the gel was run for 30 minutes at 100 volts.

Identifying the bands

For the viruses’ sizes to be identified, the gel was radiated with UV light in a machine which cause the fluorescence of the bands. A picture was taken, and the results were observed.

Results

To find out which viruses were in both samples 1 and 3, primers had to be designed. The accession codes provided to the students were used in both nucleotide and primer BLAST and the most appropriate primer was selected. The forward primer was then located in the nucleotide sequence and the results were screenshotted. The reverse primers were firstly translated into their reverse complement and then aligned to the nucleotide sequence.

Discussion

For PCR to be performed, the single-stranded RNA had to be extracted and purified to then be transcribed into complementary DNA. Both extraction and purification had to be carefully carried out to avoid any external contaminations, which would lead to the expression of the wrong genes when replicating (Burke 2018).

The nanodrop provided the value for the RNA concentration. Even though the concentration for sample 1 was low, it still shows the presence of that molecule, which means the experiment could be carried on. As mentioned before, the primers designed for this experiment were not the ones used and this explains why the size of the bands shown in figure 2 are different from what had been initially planned. Each primer was chosen according to the optimum temperature and size length of the sequence.

There were two ways the samples could have been prepared for PCR: either adding all the primers to the same tube or test each sample alone with each primer. They both lead to the same results, but it is less time consuming if the primers are all in the same Eppendorf – primers anneal to different sequences of the DNA, and so, they will only bind to their specific complementary virus, consequently producing different sized fragments (Khan Academy n.d.).

As it can be seen in figure 2, the known viruses were in wells 1, 2, 5 and 6. In the 3rd well, water was added, and it acted as negative control since there was no cDNA to it. This proves that the gel electrophoresis worked. No bands were formed for samples 1 and 3 without reverse transcriptase, which was already expected. PCR cannot amplify RNA molecules. Because the enzyme reverse transcriptase was not added to these samples, cDNA was not formed. Therefore, they could not be amplified in PCR and, as a result, no fragments were formed in the gel electrophoresis. – these samples can also act as negative controls. The bands presented at the bottom are the primers used. In an ideal situation, these bands would have been eliminated. For this to be improved, there could be an increase in the cycling parameters and change to the temperatures so it could be optimized (Roux 2009). Also, the fact that some bands are more faded than others can show signs of contaminations in the sample.

Another error was not adding loading dye to the DNA ladder; therefore, it was not possible to observe any results from wells 4 and 8. Without any DNA ladder to compare the size of the bands to, assumptions on the sizes had to be made. The DNA is negatively charged and so it is “pulled” to the positive side of the gel when the machine is on. The smallest negatively charged fragments move faster than the biggest ones (Lee, Costumbrado, Kim 2012) and, when taking that into consideration, it can be estimated that sample 1 was Influenza A and sample 3 was influenza B.

This experiment allowed the students to find out more about this virology field, where viruses are diagnosed, identified and “fought” against. Viral respiratory diseases have a great impact every year in the UK population but, fortunately, the techniques used for diagnosis and treatment are constantly becoming more efficient to avoid the spread of malignant viruses.

References

  1. Ahmed, R., Orenstein, W. (2017) Simply put: Vaccination saves lives [online] 114 (16) 4031-4033. available from [28 March 2019]
  2. Burke, B. (2018) 216BMS Cloning Lab Schedule 2018-19. Unpublished booklet. Coventry: Coventry University [1 April 2019]
  3. Cowling, B., Fang, J., Olsen, S., et al. (2014) Modes of transmission of influenza B virus in households. [online] 9 (9) n.a. available from [27 March 2019]
  4. Dasaraju, P. Liu, C. et al (1996) Medical Microbiology [online] 4th edn. Texas: Samuel Baron. available from [27 March 2019]
  5. Jacobs, S., Lamson, D., Walsh, T., et al. (2013) Human Rhinoviruses [online] 26 (1) 135- 162. available from
  6. [27 March 2019]
  7. Khan Academy (n.d.) Polymerase Chain Reaction (PCR) [online] available from [1 April 2019]
  8. Lee, P., Costumbrado, J., Kim, Y., et al. (2012) Agarose Gel Electrophoresis for the Separation of DNA Fragments [online] (62) 3923. available from [2 April 2019]
  9. Mackay, I., Arden, K., Nitsche, A. (2002) Real-time PCR in virology [online] 30 (6) 1292- 1305. available from < https://www.ncbi.nlm.nih.gov/pmc/articles/PMC101343/> [31 March 2019]
  10. Meng, J., Stobart, C., Hotard, A., et al. (2014) An Overview of Respiratory Syncytial Virus [online] 10 (4) n.a. available from [27 March 2019]
  11. Public Health England (2018) Six major respiratory viruses reported from PHE and NHS laboratories (SGSS) in England and Wales between weeks 01/2008 and 41/2018 [online] available from [27 March 2019]
  12. Roux, H. (2009) Optimization and troubleshooting in PCR. [online] available from
  13. Stanford Children’s Health (n.d.) Influenza (Flu) in Children [online] available from [27 March 2019]
  14. Storch, G. (2000) Clinical Infectious Diseases [online] 31 (3) 739-751. available from [28 March 2019]
  15. Thermo Fisher Scientific (n.d.) Overview of ELISA [online] available from [28 March 2019]
Make sure you submit a unique essay

Our writers will provide you with an essay sample written from scratch: any topic, any deadline, any instructions.

Cite this paper

Identification Of Respiratory Viruses Using Real-time PCR. (2022, February 18). Edubirdie. Retrieved July 7, 2026, from https://hub.edubirdie.com/examples/identification-of-respiratory-viruses-using-real-time-pcr/
“Identification Of Respiratory Viruses Using Real-time PCR.” Edubirdie, 18 Feb. 2022, hub.edubirdie.com/examples/identification-of-respiratory-viruses-using-real-time-pcr/
Identification Of Respiratory Viruses Using Real-time PCR. [online]. Available at: <https://hub.edubirdie.com/examples/identification-of-respiratory-viruses-using-real-time-pcr/> [Accessed 7 Jul. 2026].
Identification Of Respiratory Viruses Using Real-time PCR [Internet]. Edubirdie. 2022 Feb 18 [cited 2026 Jul 7]. Available from: https://hub.edubirdie.com/examples/identification-of-respiratory-viruses-using-real-time-pcr/
copy

Join our 150k of happy users

  • Get original paper written according to your instructions
  • Save time for what matters most
Place an order

Fair Use Policy

EduBirdie considers academic integrity to be the essential part of the learning process and does not support any violation of the academic standards. Should you have any questions regarding our Fair Use Policy or become aware of any violations, please do not hesitate to contact us via support@edubirdie.com.

Check it out!
close
search Stuck on your essay?

We are here 24/7 to write your paper in as fast as 3 hours.